| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.007145 |
| Chromosome: | chromosome 8 |
| Location: | 480183 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g359100 | TMG14,TRM11 | tRNA guanosine-2'-O-methyltransferase, TRM11; (1 of 1) 2.1.1.214 - tRNA (guanine(10)-N(2))-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCACAAGGAAAACGTTGCGCAAAGACAGTGTATGCGATGCAGCAAAGC |
| Internal bar code: | GTTCAAAGTCGCAGTGGTATTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 600 |
| LEAP-Seq percent confirming: | 88.2353 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCTACTATTGCGTCCCCCT |
| Suggested primer 2: | CGCCCATCTTGTGTTTTGCA |