| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.007194 |
| Chromosome: | chromosome 3 |
| Location: | 4368451 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g174850 | CGL111 | (1 of 1) PTHR19308:SF8 - STAR-RELATED LIPID TRANSFER PROTEIN 7, MITOCHONDRIAL; lipid-binding START protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTCAGCAACGGAGCTGCCATCCGCAGCGACCGCTGGGAACTCGAAGTT |
| Internal bar code: | AAGGATAGGCATAGAGTTTTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3147 |
| LEAP-Seq percent confirming: | 84.4828 |
| LEAP-Seq n confirming: | 49 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTCTGACTGGCTATCTGG |
| Suggested primer 2: | ACTGAGCTGGTGGTCGAAAG |