| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.007203 |
| Chromosome: | chromosome 12 |
| Location: | 4130917 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g517150 | MET16,APSR1,APR1 | Adenylylphosphosulfate reductase; (1 of 1) 1.8.99.2 - Adenylyl-sulfate reductase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACCAACCTGTGCGCAATTGAGCCCGGCCGCGGTGACCCAAGCACACTTT |
| Internal bar code: | ATATCTATGATGATCTGAGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1382 |
| LEAP-Seq percent confirming: | 84.6154 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACTTTCCCTTCTCGCTCT |
| Suggested primer 2: | GTCTGGAGTGTGCTGCTTCT |