| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.007206 |
| Chromosome: | chromosome 2 |
| Location: | 4458016 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g106250 | LAL2 | La-like RNA-binding protein; (1 of 1) IPR000504//IPR002344//IPR006630 - RNA recognition motif domain // Lupus La protein // RNA-binding protein Lupus La | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCCTAGAAGCAATGTGATGGAGGCGGCAGGGTCTCCTTAGTCTTTAGC |
| Internal bar code: | GGGGACGCTTTGGATCCCAATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1593 |
| LEAP-Seq percent confirming: | 96.875 |
| LEAP-Seq n confirming: | 31 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGGAAGTCGGGACTAGGT |
| Suggested primer 2: | AGCGGAGTGGATGCATGTAG |