Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.007232 |
Chromosome: | chromosome 17 |
Location: | 848229 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g702150 | TRX20,HCF164,CCS5 | (1 of 1) PTHR10438//PTHR10438:SF272 - THIOREDOXIN // THIOREDOXIN-LIKE PROTEIN HCF164, CHLOROPLASTIC; Thioredoxin-like protein similar to Arabidopsis HCF164 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCCTGCCTCCACCTCCGCCCCTGCCCCTCCCCCTGCCGCCGGCGGCAA |
Internal bar code: | AGCTTTGAAACTCTAGGCTGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 814 |
LEAP-Seq percent confirming: | 80.0 |
LEAP-Seq n confirming: | 20 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCCCATGATCCCTAAGCCT |
Suggested primer 2: | GGCCATGACCCAAGACAAGA |