Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.007246 |
Chromosome: | chromosome 16 |
Location: | 7554283 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g683483 | REX1-B,REX1B | (1 of 1) PF14966 - DNA repair REX1-B (DNA_repr_REX1B); DNA repair protein and protein of unknown function | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCTCGGCTCTCGATCGATAGCCTTTGTGCCTTTTGCATGCACACCGTA |
Internal bar code: | TATCAACGGGTTTGGACTCGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3337 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 25 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCGGCCCCATCTACCATACT |
Suggested primer 2: | GCTCGTGCGCATATCGTTTT |