| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.007311 |
| Chromosome: | chromosome 5 |
| Location: | 2457525 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g238950 | CGLD33 | (1 of 5) 2.1.1.34 - tRNA (guanosine(18)-2'-O)-methyltransferase / tRNA (Gm18) methyltransferase; Conserved in the Green Lineage and Diatoms | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCAGTTCCTTGAGTGGAAACCCGTTCCGGACATGCACCACCCGGAAGA |
| Internal bar code: | GCGGTTATTCCTCACTAGCGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1031 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 31 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACAAGTTCGTGGTGGGTCG |
| Suggested primer 2: | TATGCGGCTTGGGGGAAATT |