Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.007327 |
Chromosome: | chromosome 6 |
Location: | 6641793 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g294800 | CPLD37 | conserved expressed integral membrane protein; (1 of 1) IPR002489//IPR002794 - Glutamate synthase, alpha subunit, C-terminal // Protein of unknown function DUF92, TMEM19 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAAAGCGGTGGCGGGGCACAGGTGCGAAAGGTAAATCAAGAAGGGTACA |
Internal bar code: | CGGCAGGTGACTTGTAATGTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2762 |
LEAP-Seq percent confirming: | 71.4286 |
LEAP-Seq n confirming: | 20 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCTAAGACCTCGGCTGAGA |
Suggested primer 2: | CGATTGAGTGTGACCCGGAA |