| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.007327 |
| Chromosome: | chromosome 6 |
| Location: | 6641793 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g294800 | CPLD37 | conserved expressed integral membrane protein; (1 of 1) IPR002489//IPR002794 - Glutamate synthase, alpha subunit, C-terminal // Protein of unknown function DUF92, TMEM19 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAAAGCGGTGGCGGGGCACAGGTGCGAAAGGTAAATCAAGAAGGGTACA |
| Internal bar code: | CGGCAGGTGACTTGTAATGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2762 |
| LEAP-Seq percent confirming: | 71.4286 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTAAGACCTCGGCTGAGA |
| Suggested primer 2: | CGATTGAGTGTGACCCGGAA |