| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.007384 |
| Chromosome: | chromosome 3 |
| Location: | 2322784 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g158000 | GSAT,GSA,GSA1 | Glutamate-1-semialdehyde aminotransferase; (1 of 1) 5.4.3.8 - Glutamate-1-semialdehyde 2,1-aminomutase / Glutamate-1-semialdehyde aminotransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTAGGTAACATATTTGCTGGCCTCCAGCGCGGAGTGGATTCAGGCCCTG |
| Internal bar code: | CTGGGACAGTCTCCAACCCCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1323 |
| LEAP-Seq percent confirming: | 25.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCTGACGGTGACTTTCGT |
| Suggested primer 2: | TCGTGGGTGGGTAGGATGAT |