| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.007387 |
| Chromosome: | chromosome 6 |
| Location: | 3514493 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278117 | CPLD7 | Conserved in the Plant Lineage and Diatoms; (1 of 98) IPR023214 - HAD-like domain | 3'UTR |
| Cre06.g278118 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAATGTAACATAGTCCATGTCGAGTCCTACCATCAGCCTCATCCCCACAC |
| Internal bar code: | TATGGGTCGGGCGAACCTATGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 613 |
| LEAP-Seq percent confirming: | 25.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCTTGTACGCGTGTGTGGT |
| Suggested primer 2: | ACTTACAGCAACCTCCTCGC |