| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.007402 |
| Chromosome: | chromosome 7 |
| Location: | 3324801 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g334800 | FDX4,19586916 | (1 of 6) K02639 - ferredoxin (petF); Apoferredoxin, chloroplast precursor | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTTGCAAACCCGTTCTGACACACGAACTGCATCTGCGCCTGTGTCCGC |
| Internal bar code: | TTTCACGTCTATCCAGTACGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1838 |
| LEAP-Seq percent confirming: | 88.2353 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATGTCGACGCTAAAGCAG |
| Suggested primer 2: | TGAGGGCGAGTCCATCCTAA |