| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.007407 |
| Chromosome: | chromosome 15 |
| Location: | 5378845 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g734200 | DPA1 | (1 of 1) K10206 - LL-diaminopimelate aminotransferase (E2.6.1.83); putative LL-diaminopimelate aminotransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCCCAACCCACTCCTGCACCGCCGCTCCAAAACAAGCACGGGGCAACG |
| Internal bar code: | CGGTGGGGCGAGAGACCGTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 877 |
| LEAP-Seq percent confirming: | 36.3636 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGGAAAGCCAAGAGCCTGC |
| Suggested primer 2: | CGCGTTCCGGAAAACCTTTT |