| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.007411 |
| Chromosome: | chromosome 6 |
| Location: | 1009923 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g256750 | FAT1,TEH9 | Acyl carrier protein thioesterase; (1 of 1) K10782 - fatty acyl-ACP thioesterase A (FATA) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGGCCTTAGCCACCGCTGCCGCACCTCCTGCATCCCACGCCCGCCCCT |
| Internal bar code: | GTGTGCTATTATCTTTGGATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 346 |
| LEAP-Seq percent confirming: | 12.5 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATGCGCAACAGTGTTGTC |
| Suggested primer 2: | CTTGGCCAGATGACAGCTCA |