| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.007420 |
| Chromosome: | chromosome 9 |
| Location: | 5008221 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g405550 | TIM21 | Mitochondrial inner membrane translocase subunit; (1 of 1) K17796 - mitochondrial import inner membrane translocase subunit TIM21 (TIM21) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGAGCCTCCCACCTTGACGCAGAGCACCGATCACGCCCCCGCAAGATG |
| Internal bar code: | GCACCCTATGAGCTACTTTATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1042 |
| LEAP-Seq percent confirming: | 46.6667 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGTTGGATGGGGAAGACG |
| Suggested primer 2: | CCTGGTTGCATCAGGGTGAT |