| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.007454 |
| Chromosome: | chromosome 6 |
| Location: | 3786158 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278171 | CGL132 | predicted protein; (1 of 14) PF04720 - PDDEXK-like family of unknown function (PDDEXK_6) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATACGGCATGCACACGCACATCGTCACAGTCGCCGTATTATGTTTTGAG |
| Internal bar code: | ATTAGTTTCACTCGCAATGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2348 |
| LEAP-Seq percent confirming: | 59.0361 |
| LEAP-Seq n confirming: | 49 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 83 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAACAGCAGCAACAGCAACA |
| Suggested primer 2: | TCCATGTCAACACCCTGAGC |