| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.007470 |
| Chromosome: | chromosome 2 |
| Location: | 4485536 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g106600 | RPS19 | Cytosolic 80S ribosomal protein S19; (1 of 1) K02966 - small subunit ribosomal protein S19e (RP-S19e, RPS19) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACACGTGCGCCGAATACAAGCCGTTCCATTTCACGGCCAGCCTCCTCCC |
| Internal bar code: | ATCGTGTTGAAGTATGCGAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 782 |
| LEAP-Seq percent confirming: | 90.0 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGTTCCAGTCCAAGGCTT |
| Suggested primer 2: | ACAACGCAAACGCAGTACAC |