| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.007475 |
| Chromosome: | chromosome 12 |
| Location: | 771621 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g492450 | SPL18 | (1 of 2) PTHR18934:SF145 - ATP-DEPENDENT RNA HELICASE DHX57-RELATED; ATP-dependent RNA helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAAGACGGAGTGTCCAGGGGTTGACAGCCAAGGCACAAACGCATTGAT |
| Internal bar code: | GCGGCACCAGGTTGGTCACCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1194 |
| LEAP-Seq percent confirming: | 96.7742 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTACTCCGCAAAGAGCTGG |
| Suggested primer 2: | CCCGCCATACAACAACTCCT |