Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.007495 |
Chromosome: | chromosome 2 |
Location: | 4867778 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g109600 | INM1,IPP3 | Inositol monophosphatase; (1 of 2) K01092 - myo-inositol-1(or 4)-monophosphatase (E3.1.3.25, IMPA, suhB) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCCACGCCTCGTCGTGCTCGTAGCCGAACCCCGTCACCAGCAGCGAGC |
Internal bar code: | CGGCGAAACGTTGAACCGCACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 621 |
LEAP-Seq percent confirming: | 33.3333 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCATCCAGTGTTACTGCCCT |
Suggested primer 2: | GCCTGAGGAAGAGAGGGAGA |