| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.007496 |
| Chromosome: | chromosome 17 |
| Location: | 2058659 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g711150 | FAD2a,FAD2 | Fatty acid desaturase, delta-12; (1 of 1) K10256 - omega-6 fatty acid desaturase (delta-12 desaturase) (FAD2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTACGGCACGGCGCGGTGTGCTGACTCACCAGCCAGTGGTTGACCACC |
| Internal bar code: | CAGGACGGTTCTGGATATATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 827 |
| LEAP-Seq percent confirming: | 78.2609 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTCCCGTGCTTACACCAT |
| Suggested primer 2: | GCATACACGCGTACACACAC |