| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.007511 |
| Chromosome: | chromosome 3 |
| Location: | 4143564 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g172850 | OASTL3,ASL3 | (1 of 3) 2.5.1.47 - Cysteine synthase / OAS sulfhydrylase; O-acetylserine (Thiol)-lyase/cysteine synthase 3 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACGTTGAAACGCACGACGGCCAAGCCCGCACGCAATCTACCGTGCTCA |
| Internal bar code: | TATTACACCTGGCATCATCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1443 |
| LEAP-Seq percent confirming: | 93.8775 |
| LEAP-Seq n confirming: | 46 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATAGCAGGAGCAGGAGCAG |
| Suggested primer 2: | AGGAGGAGCCGACAAAATGG |