| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.007522 |
| Chromosome: | chromosome 3 |
| Location: | 5991517 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g189500 | (1 of 3) K03574 - 8-oxo-dGTP diphosphatase [EC:3.6.1.55] (mutT, NUDT15, MTH2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATCGGGTACGGTGCAGTAACTGCTGGATAAATGCAGCTGACGTTGGCCG |
| Internal bar code: | GTGGTAAACGCATTTCGGCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3071 |
| LEAP-Seq percent confirming: | 94.8718 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGCTAGGCATGCTTAGGTA |
| Suggested primer 2: | GGCAAGCTCGGCAAAAAGAA |