Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.007553 |
Chromosome: | chromosome 9 |
Location: | 3067724 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g393954 | FAP106 | Flagellar Associated Protein 106; (1 of 1) PTHR21490:SF0 - ENKURIN | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCAAAAGATCCGGCCACCGGTGCCGGCCAAAGAGGAGAAGCCCACTAT |
Internal bar code: | TGGCAAACTGCTGGGTGACTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1555 |
LEAP-Seq percent confirming: | 10.8108 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 33 |
LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCCACAACAACAGTCACTG |
Suggested primer 2: | CCACTGTCACTGCCTAGCAA |