| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.007570 |
| Chromosome: | chromosome 16 |
| Location: | 5891617 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g679300 | CGL139 | Conserved in the Green Lineage | 3'UTR |
| Cre16.g679350 | (1 of 3) IPR003131//IPR011333 - Potassium channel tetramerisation-type BTB domain // POZ domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAATGGGTCGGTGACTCCGTGTACGTCACTGCCTCACATCCTCCCTACG |
| Internal bar code: | CTTGCTGTCCAACAGAACGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 730 |
| LEAP-Seq percent confirming: | 55.5556 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCTACCGTATCACTGCCC |
| Suggested primer 2: | CTGGGCGCCATTCTAAAGGA |