| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.007575 |
| Chromosome: | plastome |
| Location: | 105894 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802310 | 2716997,rps3,ChreCp046 | 30S ribosomal protein S3; (1 of 1) PTHR11760//PTHR11760:SF19 - 30S/40S RIBOSOMAL PROTEIN S3 // 30S RIBOSOMAL PROTEIN S3, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGCTGCTCGCGATATTTATATACTAGGGTTTGCATACTCTGAAAGACG |
| Internal bar code: | GTGACCGTTATTACCTGCCAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 165 |
| LEAP-Seq percent confirming: | 87.5 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTACCACCACTGCCTCCTTC |
| Suggested primer 2: | CAACAATTGCGACTGCTCGT |