Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.007583 |
Chromosome: | chromosome 6 |
Location: | 6815569 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g296250 | SYK1,TSK2 | Putative organellar lysyl-tRNA synthetase, tRNA synthetase class II (D, K and N) family protein; (1 of 1) PTHR22594//PTHR22594:SF4 - ASPARTYL/LYSYL-TRNA SYNTHETASE // LYSINE--TRNA LIGASE-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCCCTTCCCCCCAAAAAAACGCTCCGAACCACCCTGACAGCCGCAGTC |
Internal bar code: | CTTGGCATAACGCATATATGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 348 |
LEAP-Seq percent confirming: | 7.89474 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 35 |
LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCCGTCGCTAGTTCGAGTC |
Suggested primer 2: | ACCCTCCCACCTGGTAGATC |