| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.007629 |
| Chromosome: | chromosome 3 |
| Location: | 589876 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g145387 | FAP239 | Coiled-Coil Flagellar Associated Protein 239 | 5'UTR |
| Cre03.g145407 | (1 of 2) IPR000571//IPR002110//IPR020683 - Zinc finger, CCCH-type // Ankyrin repeat // Ankyrin repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGAACTGGACCTTGCTGCCCCTAGATGCGCGCCCTCACACGTCAAACAG |
| Internal bar code: | GGTGAATCCACTACCTCATCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5341 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 61 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGCACGAGTGAGGAAAGG |
| Suggested primer 2: | ACAGGAAGTCGAGCACACTG |