| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.007640 |
| Chromosome: | chromosome 15 |
| Location: | 5481281 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g733650 | BIO3,BIOF | 7-keto-8-aminopelargonic acid synthase; (1 of 1) K00652 - 8-amino-7-oxononanoate synthase (bioF) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATCATCAATGGCAATACTGTCTCAGGTAGCAATGTTCTTGCTCGATCCG |
| Internal bar code: | GCGGAGCCCACATTTCCAGATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1801 |
| LEAP-Seq percent confirming: | 14.2857 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAGGTTGCATGTGGGATGG |
| Suggested primer 2: | GTGGATGGGTATAGCTGGGC |