| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.007647 |
| Chromosome: | chromosome 16 |
| Location: | 7794149 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g687966 | FAP5,Nphp3 | Flagellar Associated Protein 5; (1 of 2) PTHR19959//PTHR19959:SF147 - KINESIN LIGHT CHAIN // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCCGCCTGGGGCTGGTGTGGCGGCCCAGCGGCCGCACCCACGCCCTG |
| Internal bar code: | GCGTGGTATGCTATGATTGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2680 |
| LEAP-Seq percent confirming: | 80.0 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGGAACAGTAGCACAGCA |
| Suggested primer 2: | CAGCCACAGGGAGAACAGAG |