Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.007652 |
Chromosome: | chromosome 6 |
Location: | 2053411 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g265800 | PRPL28 | Chloroplast ribosomal protein L28, imported to chloroplast; (1 of 1) PTHR13528//PTHR13528:SF5 - 39S RIBOSOMAL PROTEIN L28, MITOCHONDRIAL // SUBFAMILY NOT NAMED | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGATTGTGGGTAGTCGGCGAGCTCTCACAGCCTCCATCCCACAGCAATT |
Internal bar code: | TGGGTTGAGCCCTAACAAGCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2501 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 36 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGTACTTGGGCTGCTTCTT |
Suggested primer 2: | ACGGAAATGCAAGTTGTGGC |