| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.007668 |
| Chromosome: | chromosome 8 |
| Location: | 2490915 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g372450 | PSBQ1,OEE3, PSBQ | (1 of 1) K08901 - photosystem II oxygen-evolving enhancer protein 3 (psbQ); Photosystem II Oxygen Evolution Enhancer protein 3 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTTCAACCTAATAGCAAAGATGGCCCTCGCCTCTAAGGTTGCTACCCG |
| Internal bar code: | GCACGGTGTAGTCTGGGGACAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4236 |
| LEAP-Seq percent confirming: | 98.4615 |
| LEAP-Seq n confirming: | 64 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAAACATGCCGCACCTTTT |
| Suggested primer 2: | CAAGGGAGCTTGGAAGGGAG |