Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.007684 |
Chromosome: | chromosome 2 |
Location: | 3631251 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g099850 | PDC2 | (1 of 1) PTHR11516:SF25 - PYRUVATE DEHYDROGENASE E1 COMPONENT SUBUNIT ALPHA-3, CHLOROPLASTIC; Pyruvate dehydrogenase, E1 component, alpha subunit | 5'UTR_intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTCCAGCGACGGAGGCCCACAGCAGCATGATCGTTGCAGCCTCTGCTAT |
Internal bar code: | TGGGAAGGGCCATCAACCGTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1656 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGATGGGCGACTTAGAGGTC |
Suggested primer 2: | CGCAGTCTGCTACGCAAATC |