Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.007688 |
Chromosome: | chromosome 4 |
Location: | 1695263 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g212300 | PPP17 | (1 of 1) PTHR13832:SF224 - PROTEIN PHOSPHATASE 2C 70; Phosphoprotein phosphatase 2C-related | 5'UTR_intron |
Cre04.g212350 | (1 of 2) PF10013 - Uncharacterized protein conserved in bacteria (DUF2256) (DUF2256) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGATGCGCATTGGGTCAATTGGCATATCGGGAACATGGGGGAATGAAA |
Internal bar code: | ATACTTCCCTTCGTTGATTGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3321 |
LEAP-Seq percent confirming: | 84.0 |
LEAP-Seq n confirming: | 21 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCAGGCATCCTTTGGACTC |
Suggested primer 2: | GGCCACCTCGGTCATACAAA |