Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.007696 |
Chromosome: | chromosome 13 |
Location: | 1907074 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g575850 | (1 of 10) PF13460 - NAD(P)H-binding (NAD_binding_10) | 3'UTR | |
Cre13.g575900 | CGL117 | (1 of 1) PF04959//PF12066 - Arsenite-resistance protein 2 (ARS2) // Domain of unknown function (DUF3546) (DUF3546); predicted protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTATCCAACGCGGCTGCAAGGGCCTGTTGCAGATGCTACGACTGTTGT |
Internal bar code: | GACTATCGTCTCATGGTTAAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2732 |
LEAP-Seq percent confirming: | 44.4444 |
LEAP-Seq n confirming: | 32 |
LEAP-Seq n nonconfirming: | 40 |
LEAP-Seq n unique pos: | 72 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGGCGTGAGTACCATACGG |
Suggested primer 2: | CGGAATGCGCGAGTACTTTG |