| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.007703 |
| Chromosome: | chromosome 1 |
| Location: | 6195504 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g044150 | (1 of 1) 2.1.1.181 - 23S rRNA (adenine(1618)-N(6))-methyltransferase / rRNA large subunit methyltransferase F | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGCCTGGTCCCACGACCGGGCACGCCTCGAAACCATCACTGATGCCCG |
| Internal bar code: | CGCCCAATAATAACCTGTGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3890 |
| LEAP-Seq percent confirming: | 41.9355 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGTAAAGCGCCCAACTGC |
| Suggested primer 2: | AGTAGCAGCCTGAGCAGTTG |