| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.007709 |
| Chromosome: | chromosome 2 |
| Location: | 8268146 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g143400 | PDE27 | (1 of 1) K18437 - high affinity cAMP-specific and IBMX-insensitive 3',5'-cyclic phosphodiesterase 8 (PDE8); 3'%252C5'-cyclic-nucleotide phosphodiesterase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCAATGCAGCCAGCTATTTGAAGCTAAGGGGCGCGGCGGCGTACACG |
| Internal bar code: | GTGTTGAATTTAAGGTCAACTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2888 |
| LEAP-Seq percent confirming: | 97.9592 |
| LEAP-Seq n confirming: | 48 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGCGGGATAAGGGATGTC |
| Suggested primer 2: | GCACTAGTATCCGCACCTCC |