| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.007754 |
| Chromosome: | chromosome 10 |
| Location: | 3061769 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g441050 | (1 of 2) PTHR12321:SF55 - PHD FINGER PROTEIN ALFIN-LIKE 4 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGAGAACCTCTGCCTGTACGCATACCAGGACGGGACGTGGGCGTGCGA |
| Internal bar code: | TATCACTAACTGAGGCCTGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5035 |
| LEAP-Seq percent confirming: | 98.5714 |
| LEAP-Seq n confirming: | 69 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 70 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGACTAGGCTGATCCAGTC |
| Suggested primer 2: | GTTAGTTGGCCCGTTGCTTG |