| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.007757 |
| Chromosome: | chromosome 9 |
| Location: | 1932380 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g397150 | (1 of 1) 3.4.17.23 - Angiotensin-converting enzyme 2 / Angiotensin converting enzyme-2 | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGCGGAAATCCTGAGCTTGAGGGAATTAGCTTGACACTCGAAAGCATT |
| Internal bar code: | TTCAGGTAGAGTGAGTTACTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 309 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAAGTAAACACCGAGGCCC |
| Suggested primer 2: | CCAGCCAAGCATCCTTCTGA |