Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.007766 |
Chromosome: | chromosome 1 |
Location: | 2606360 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g015500 | CGL91 | (1 of 18) PTHR10774 - EXTENDED SYNAPTOTAGMIN-RELATED; Conserved in the Green Lineage | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCAACGAGAACACGCTGGAGCTGACGCTGATGGACGAGGACACGCTCAC |
Internal bar code: | AGTAAAAAGTCATGTCGGCCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3226 |
LEAP-Seq percent confirming: | 86.9565 |
LEAP-Seq n confirming: | 40 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCCATCTGCCAATCCCCAC |
Suggested primer 2: | ACACGAAACGGAAGCGTACT |