Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.007800 |
Chromosome: | chromosome 9 |
Location: | 2323281 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g394350 | NUP155 | Nucleoporin 155; (1 of 1) K14312 - nuclear pore complex protein Nup155 (NUP155, NUP170, NUP157) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACCGCTAGGGTACCGTCACCGTCGCTTCAAGCTCACAATCATCCTCCAC |
Internal bar code: | TAAGGGGAGTTTCCGTCTCTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 500 |
LEAP-Seq percent confirming: | 27.2727 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGATCCTGCGCCAATCCTAT |
Suggested primer 2: | TCCCCAAGATCGTCTACCGT |