| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.007807 |
| Chromosome: | chromosome 4 |
| Location: | 3470974 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g227800 | (1 of 1) IPR001480//IPR018392 - Bulb-type lectin domain // LysM domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTAGACCAGCTGCAGCAGGACCCTAGCTCTGGCGGCAGCGCACCGGGC |
| Internal bar code: | CCTGTCACGCACAGACCGGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1511 |
| LEAP-Seq percent confirming: | 56.25 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTATGCACACCAGGACCACA |
| Suggested primer 2: | GTGGCAATGGTAACGCTGAG |