| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.007827 |
| Chromosome: | chromosome 9 |
| Location: | 2055885 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g396451 | GOX15 | (1 of 1) IPR011043//IPR014756//IPR015202 - Galactose oxidase/kelch, beta-propeller // Immunoglobulin E-set // Domain of unknown function DUF1929; Glyoxal oxidase 15 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCTCTGACGCGATGTGGCCCCCGCCGTGCATGATGGGCGGCGGCAGGC |
| Internal bar code: | TCTCACCCTTTTCGTGCTTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1714 |
| LEAP-Seq percent confirming: | 90.3226 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCGCCTACCTAAGTAGCAG |
| Suggested primer 2: | TGGTGGGGTCGAACATGATG |