| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.007848 |
| Chromosome: | chromosome 16 |
| Location: | 1188508 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g650600 | MST1 | Mastigoneme-like flagellar protein; (1 of 4) IPR009030//IPR011641 - Insulin-like growth factor binding protein, N-terminal // Tyrosine-protein kinase ephrin type A/B receptor-like | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGCGAAGCCTGGCGTTCTTGCTGCCGGTGGAGGTGTACCTGAACGTCG |
| Internal bar code: | ATTTAAGGAATATGCGTGTTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3013 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 99 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 99 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGACGCTTCGCTTGTATG |
| Suggested primer 2: | GCTGCGCTGAATCCTAAACG |