| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.007864 |
| Chromosome: | chromosome 3 |
| Location: | 5096146 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g180450 | FPN1,FAP215 | (1 of 3) K01081 - 5'-nucleotidase (E3.1.3.5); Flagellar Associated Protein 215, 5'-nucleotidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAGCCACCACTCACTTGTTGAGGCTCTTGCTGGACTTGGTCTGCTTGAG |
| Internal bar code: | AATCCTTCTCTTAAACTCATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3116 |
| LEAP-Seq percent confirming: | 98.2456 |
| LEAP-Seq n confirming: | 56 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTGACGAACTTTCCTCCA |
| Suggested primer 2: | CCCCCGTCATCAGATGTAGC |