Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.007879 |
Chromosome: | chromosome 2 |
Location: | 1204054 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g081600 | PFH8,PHX3,P4H8 | Prolyl 4-hydroxylase 8; (1 of 14) K00472 - prolyl 4-hydroxylase (E1.14.11.2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCTTGCCTCCCGGCCTCACACCCCGCCGGGCATCACCCCGCCTGGGTG |
Internal bar code: | CAATCCGGATATAATAAGGTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2072 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 38 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCCTCCCAGTACGGTGTAT |
Suggested primer 2: | TCCACTACCCCCACGATCAT |