| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.007919 |
| Chromosome: | chromosome 10 |
| Location: | 5680173 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g459200 | PMA2,ACA4 | (1 of 3) K01535 - H+-transporting ATPase (E3.6.3.6); P-type ATPase/cation transporter, plasma membrane | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAATTCACAGATTGACCAGGCCGCCCTGACCGGTGAGTCGCTGCCCGC |
| Internal bar code: | CCGATTTTGGGTCCTGTCGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1853 |
| LEAP-Seq percent confirming: | 42.1053 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTCTTGTCCGAGCACAGAA |
| Suggested primer 2: | GAGGTTAAGGTGGCGGTCAA |