Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.007920 |
Chromosome: | chromosome 6 |
Location: | 2749459 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g271150 | FAP74,C1d-HC3 | (1 of 6) PF14874 - Flagellar-associated PapD-like (PapD-like); Flagellar Associated Protein 74 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCATCCATGGATGGCTGGCCCCGCCCGCCAATTTCCACCCAAGTCGCC |
Internal bar code: | ATTTTCCTTGGGTATTGGTGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2203 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCACGTCCCTGTACAAGTG |
Suggested primer 2: | ACCCATTGACGCTTTGTTGC |