| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.008006 |
| Chromosome: | plastome |
| Location: | 195131 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802335 | rpoC1,ChreCp069,2717049 | (1 of 2) K03046 - DNA-directed RNA polymerase subunit beta' (rpoC); RNA polymerase beta' chain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTTAACTCACTTGTGAGTTAACATATATAATCCATGACCAGCTTTTTT |
| Internal bar code: | GCAGGGAGTCTCGCATAATGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 63 |
| LEAP-Seq percent confirming: | 8.33333 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCCATGCTTTGCCCCTTA |
| Suggested primer 2: | AGTTGCTGCTTCGGGAAGAT |