| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.008048 |
| Chromosome: | chromosome 16 |
| Location: | 7653978 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g685277 | AP2M2 | Mu2-Adaptin; (1 of 1) K11826 - AP-2 complex subunit mu-1 (AP2M1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATGTGCCCCCCAGCACGCACCTGCGGGAGCCCGTAGTCCATCACCTCG |
| Internal bar code: | AAAAGAATCTACGGTGTGATTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1593 |
| LEAP-Seq percent confirming: | 80.0 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAACGATCGGAACCCTGTG |
| Suggested primer 2: | CGTCAGAACCCCAATGAGCT |