| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.008138 |
| Chromosome: | chromosome 12 |
| Location: | 4057479 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g516450 | CAG1 | Gamma carbonic anhydrase 1; (1 of 1) PTHR13061//PTHR13061:SF7 - DYNACTIN SUBUNIT P25 // SUBFAMILY NOT NAMED | CDS |
| Cre12.g516500 | CUL4,CUL2 | (1 of 1) K10609 - cullin 4 (CUL4); Ubiquitin ligase SCF complex subunit Cullin | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGACACTAGTTTGTGACTGCACCAGCGTTGAGAGGGCATATGGGGCAA |
| Internal bar code: | ACGGGCCGCTGTTCCTTTTATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1789 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 51 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAACTTCCCACCGTGTACA |
| Suggested primer 2: | CCAACCGAAACGTTGTCACC |