| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.008176 |
| Chromosome: | chromosome 7 |
| Location: | 468032 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g315500 | (1 of 8) IPR001810//IPR006553 - F-box domain // Leucine-rich repeat, cysteine-containing subtype | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCGCGGGCAAGGCCGCGCTGTTGGACTGGGTGACGGGCATGACCTCGC |
| Internal bar code: | TCTTTATCAGCAATGTGCGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 807 |
| LEAP-Seq percent confirming: | 52.6316 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCTCGGGGAAACTGATGT |
| Suggested primer 2: | TCACATGAGGGAGCAAGCAG |